BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K101010 1 BBa_K101010 Dual-Repressed Promoter for p22 cII and TetR with RBS attached 2008-07-27T11:00:00Z 2015-05-08T01:08:42Z This part was constructed from BioBrick parts BBa_K101002 (Dual Promoter) and BBa_B0032 (medium strength RBS). This composite part consists of a dually-repressed promoter with a medium strength RBS attached. The promoter is repressed by either p22 cII or TetR proteins. The medium strength RBS was attached to make this promoter easier to use with any protein that may need to be attached to it. When the RBS is already on the promoter, a simpler ligation can occur that attaches the protein to this promoter, instead of having to attach a small RBS before this ligation can occur. false false _205_ 0 3363 9 Not in stock false There were no real design considerations needed for this part. All that was done was to use PCR to add the small RBS fragment to the dual promoter construct. false Bennett Swiniarski component1968819 1 BBa_K101002 component1968821 1 BBa_B0032 annotation1968819 1 BBa_K101002 range1968819 1 1 66 annotation1968821 1 BBa_B0032 range1968821 1 75 87 BBa_K101002 1 BBa_K101002 Dual-Repressed Promoter for p22 cII and TetR 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z This part was designed by combining sequences from parts R0040 (TetR promoter) and R0053 (p22 cII promoter). k;kljg false false _205_ 0 3363 9 Not in stock false TetR usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. However, p22 mnt also has two operator sites, one between -35 and -10 and another downstream from -10. Since each had an operator site in between -35 and -10, we had to eliminate the TetR operator site in order to allow the promoter to work. TetR was picked because it has a stronger binding than p22 mnt, and so would be more able to use only one site to bind. false Bennett Swiniarski BBa_K101002_sequence 1 tccctatcagtgatagagattgactaaagattcctttagtagataatttaagtgttctttaatttc BBa_K101010_sequence 1 tccctatcagtgatagagattgactaaagattcctttagtagataatttaagtgttctttaatttctactagagtcacacaggaaag BBa_B0032_sequence 1 tcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z