BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K101011 1 BBa_K101011 Dual-Repressed Promoter for LacI and Lambda cI + RBS (med strength) 2008-07-27T11:00:00Z 2015-05-08T01:08:42Z This part combines BBa_K101001, the dually-repressed promoter, with BBa_B0032, a medium strength RBS with good characterization and experience by other registry users. This promoter will be repressed in the presence of the LacI protein from E. coli, the cI protein from the Lambda phage, or both. A medium strength RBS has been incorporated for convenient cloning to a desired gene. false false _205_ 0 3296 9 Not in stock false This promoter contains two lambda cI operator sites; one upstream of the -35 polymerase binding site, and another between the -35 and -10 binding sites. It also includes a LacI operator site downstream of the -10 polymerase binding site. -35 and -10 sites were derived from the cI repressed promoter from lambda phage. A CAP binding site is also included for effective repression. For information concerning the RBS design, please see part BBa_B0032. false Kristen J Lindblad component1968915 1 BBa_B0032 component1968913 1 BBa_K101001 annotation1968915 1 BBa_B0032 range1968915 1 125 137 annotation1968913 1 BBa_K101001 range1968913 1 1 116 BBa_K101001 1 BBa_K101001 Dual-Repressed Promoter for LacI and LambdacI 2008-07-27T11:00:00Z 2015-05-08T01:08:41Z This part was made by combining BioBrick parts R0010(LacI promoter) and R0051 (LambdacI promoter), along with intermediate sequence between these operator sites. This part is a new construct of a promoter that is dually repressed by either LacI or LambdacI proteins. false false _205_ 0 3363 9 Not in stock false LambdacI usually binds to two operator sites, one located upstream from -35 and one located between -35 and -10. By itself, LacI binds downstream from -10. This made the part design very straightforward, since the locations of the operator sites do not overlap at all. In order to complete this part, we simply combined the proper sequences and we had a dually-repressed promoter. false Bennett Swiniarski BBa_K101011_sequence 1 gcgcaacgcaattaatgtgagttagctcactcattaggcataacaccgtgcgtgttgactattttacctctggcggtgataatgtgtggaattgtgagcggataaaatttcacacatactagagtcacacaggaaag BBa_K101001_sequence 1 gcgcaacgcaattaatgtgagttagctcactcattaggcataacaccgtgcgtgttgactattttacctctggcggtgataatgtgtggaattgtgagcggataaaatttcacaca BBa_B0032_sequence 1 tcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z