BBa_K101017 1 MioC MioC Promoter (DNAa-Repressed Promoter) 2008-10-27T12:00:00Z 2015-05-08T01:08:42Z The source of this part is from the genomic dna of E.coli (JM109). The MioC promoter is a cell-cycle dependent promoter that is repressed before initiation of replication and depressed shortly after. The regulation of the MioC gene is overseen by several DNAa proteins, which bind along the promoter. This particular MioC promoter was isolated from K-12 (JM109). This promoter can be used in series with a reporter to signal only during a given part of the cell cycle. false false _205_ 0 2728 9 It's complicated false Site directed mutagenesis was used to create a Spe1 restriction site. false Karl Petersen annotation1992601 1 DNAa Binding Box range1992601 1 295 303 annotation1992615 1 MioC Promoter range1992615 1 131 319 annotation1992609 1 DNAa Binding Box range1992609 1 159 167 annotation1992607 1 DNAa Binding Box range1992607 1 273 279 annotation1992605 1 DNAa Binding Box range1992605 1 283 292 BBa_K101017_sequence 1 gaattcgcggccgcttctagaggagcgccaaagactacccttccgcgctggcaaagctggaaagccttgatgaagtcactgaagcctattacacaaccggccactacagcatctttataaaagtgatgtgccgttcgatcgacgctctccagcatgtacttatcaacaagatccaaacaattgatgaaattcagtccaccgagacattgatcgtcctgcaaaacccgatcatgcgtaccatcaagccctgatcggcttttttaatcccatacttttccacaggtagatcccaacgcgttcacagcgtacaattactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z