BBa_K1012002 1 BBa_K1012002 The TorA twin-arginine signal sequence 2013-08-28T11:00:00Z 2015-05-08T01:08:42Z Published paper, reference needed Protein phosphatase 1 (PP1,human protein) with N terminal TorA signal sequence and C terminal hemagglutinin (HA) tag. TorA signal sequence is taken from E. coli TMAO reductase. This will target the protein for Tat transport. HA tag is attached for identification of PP1 with Western blots. false false _1318_ 0 15739 9 It's complicated true PP1 contained PstI site, this was removed by quick change. TorA signal sequence was added by standard cloning proceudres. false John Allan BBa_K1012002_sequence 1 atgaacaataacgatctctttcaggcatcacgtcggcgttttctggcacaactcggcggcttaaccgtggccgggatgctggggccgtcattgttaacgccgcgacgtgcgactgcggcgcaagcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z