BBa_K1012004 1 BBa_K1012004 The maltose binding protein (MalE) signal sequence 2013-08-28T11:00:00Z 2015-05-08T01:08:42Z Published paper, reference needed Protein phosphatase 1 (PP1, human protein) with N terminal MalE signal sequence, and C terminal hemagglutinin tag. MalE signal sequence is taken from E. coli maltose binding protein. This signal will target the protein for Sec transport. HA tag can be used for identification of PP1 by Western blot. false false _1318_ 0 15739 9 It's complicated false PP1 contained a PstI site which was removed by quick change. MalE signal sequence was added by standard cloning methods. false John Allan BBa_K1012004_sequence 1 atgaaaataaaaacaggtgcacgcatcctcgcattatccgcattaacgacgatgatgttttccgcctcggctctcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z