BBa_K1014000 1 BBa_K1014000 HrpS Gene 2013-08-27T11:00:00Z 2015-05-08T01:08:42Z E.coli This codes for HrpS protein which is needed for hrpL AND Gate false false _1320_ 0 11931 9 In stock false JCAT false Xiangmiao Zeng BBa_K1014007 1 BBa_K1014007 HrpS Protein Generator(W) 2013-08-28T11:00:00Z 2015-05-08T01:08:42Z E.coli This device will produce HrpS protein constitutively under weak RBS and is repressed by TetR. false false _999_1320_ 0 11931 9 In stock false JCAT false Xiangmiao Zeng component2334799 1 BBa_B0031 component2334793 1 BBa_R0040 component2334801 1 BBa_B0010 component2334800 1 BBa_K1014000 component2334803 1 BBa_B0012 annotation2334800 1 BBa_K1014000 range2334800 1 83 1069 annotation2334793 1 BBa_R0040 range2334793 1 1 54 annotation2334799 1 BBa_B0031 range2334799 1 63 76 annotation2334801 1 BBa_B0010 range2334801 1 1078 1157 annotation2334803 1 BBa_B0012 range2334803 1 1166 1206 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1014000_sequence 1 atgaccatccgtaactctaacgaatctgttcagtctctgcactgcgcttctcacgaatcttctctgacccacccgtctgaagacatccacggttctctgtcttctctgatccacaccatcgctccgctgaacgttgacatcgttctggaaggtgaaaccggtaccggtaaagacaccctggctcgtcgtatccaccagctgtctggttgcgctggtccgctggttgctgttaactgcgctgctgttccggaaaccctggctgaatctgaactgttcggtgttgtttctggtgcttacaccggtgcttctcgttctcgtgctggttacctggaaaccgctgacaaaggtatcctgttcctggacgaaatcgactctatgccgctgaccctgcaagctaaaatgctgcgtgttctggaatctcgtggtatcgaacgtctgggttctacccagttcaaaccggttgacatgcgtgttatcgttgctacccagaccccgctgcaaaaactggttgacgaaggtcgtttccgtcgtgacctgtacttccgtctggacaccgttaaaatccagctgccgaccctgcgttctcgtaccgaaatcatcctgccgctgttcgaacgtttcctgctggaagcttctgctcgtctgaaacgtccggctccgggtctgtctgctatcatccaggaacagctgctgatgcacggttggccgggtaacatccgtgaactgaaagctgctgctgaacgttgggttctgggtctgtctccggttccgatcgcttctgacggtgacgttcaggttatgggtgaagacaccccgctgacctctctgaaagttcgtctgcgtcgtatagagaggttcctgatccaggaggctctgcaacgtaacgaccactgcatcgacaccgttgttaacgaactgggtatcccgaaacgtaccctgtaccaccgtatcaaactgctgaacgttgctgctcgtggtctgtaataa BBa_B0031_sequence 1 tcacacaggaaacc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1014007_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaacctactagatgaccatccgtaactctaacgaatctgttcagtctctgcactgcgcttctcacgaatcttctctgacccacccgtctgaagacatccacggttctctgtcttctctgatccacaccatcgctccgctgaacgttgacatcgttctggaaggtgaaaccggtaccggtaaagacaccctggctcgtcgtatccaccagctgtctggttgcgctggtccgctggttgctgttaactgcgctgctgttccggaaaccctggctgaatctgaactgttcggtgttgtttctggtgcttacaccggtgcttctcgttctcgtgctggttacctggaaaccgctgacaaaggtatcctgttcctggacgaaatcgactctatgccgctgaccctgcaagctaaaatgctgcgtgttctggaatctcgtggtatcgaacgtctgggttctacccagttcaaaccggttgacatgcgtgttatcgttgctacccagaccccgctgcaaaaactggttgacgaaggtcgtttccgtcgtgacctgtacttccgtctggacaccgttaaaatccagctgccgaccctgcgttctcgtaccgaaatcatcctgccgctgttcgaacgtttcctgctggaagcttctgctcgtctgaaacgtccggctccgggtctgtctgctatcatccaggaacagctgctgatgcacggttggccgggtaacatccgtgaactgaaagctgctgctgaacgttgggttctgggtctgtctccggttccgatcgcttctgacggtgacgttcaggttatgggtgaagacaccccgctgacctctctgaaagttcgtctgcgtcgtatagagaggttcctgatccaggaggctctgcaacgtaacgaccactgcatcgacaccgttgttaacgaactgggtatcccgaaacgtaccctgtaccaccgtatcaaactgctgaacgttgctgctcgtggtctgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z