BBa_K1014000 1 BBa_K1014000 HrpS Gene 2013-08-27T11:00:00Z 2015-05-08T01:08:42Z E.coli This codes for HrpS protein which is needed for hrpL AND Gate false false _1320_ 0 11931 9 In stock false JCAT false Xiangmiao Zeng BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K1014016 1 BBa_K1014016 HrpS Protein Generator 2013-08-27T11:00:00Z 2015-05-08T01:08:42Z E.coli This device will produce HrpS protein constitutively and is repressed by TetR. false false _999_1320_ 0 11931 9 It's complicated false n/a false Xiangmiao Zeng component2333270 1 BBa_B0012 component2333259 1 BBa_R0040 component2333267 1 BBa_K1014000 component2333265 1 BBa_B0030 component2333268 1 BBa_B0010 annotation2333270 1 BBa_B0012 range2333270 1 1167 1207 annotation2333265 1 BBa_B0030 range2333265 1 63 77 annotation2333268 1 BBa_B0010 range2333268 1 1079 1158 annotation2333259 1 BBa_R0040 range2333259 1 1 54 annotation2333267 1 BBa_K1014000 range2333267 1 84 1070 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1014000_sequence 1 atgaccatccgtaactctaacgaatctgttcagtctctgcactgcgcttctcacgaatcttctctgacccacccgtctgaagacatccacggttctctgtcttctctgatccacaccatcgctccgctgaacgttgacatcgttctggaaggtgaaaccggtaccggtaaagacaccctggctcgtcgtatccaccagctgtctggttgcgctggtccgctggttgctgttaactgcgctgctgttccggaaaccctggctgaatctgaactgttcggtgttgtttctggtgcttacaccggtgcttctcgttctcgtgctggttacctggaaaccgctgacaaaggtatcctgttcctggacgaaatcgactctatgccgctgaccctgcaagctaaaatgctgcgtgttctggaatctcgtggtatcgaacgtctgggttctacccagttcaaaccggttgacatgcgtgttatcgttgctacccagaccccgctgcaaaaactggttgacgaaggtcgtttccgtcgtgacctgtacttccgtctggacaccgttaaaatccagctgccgaccctgcgttctcgtaccgaaatcatcctgccgctgttcgaacgtttcctgctggaagcttctgctcgtctgaaacgtccggctccgggtctgtctgctatcatccaggaacagctgctgatgcacggttggccgggtaacatccgtgaactgaaagctgctgctgaacgttgggttctgggtctgtctccggttccgatcgcttctgacggtgacgttcaggttatgggtgaagacaccccgctgacctctctgaaagttcgtctgcgtcgtatagagaggttcctgatccaggaggctctgcaacgtaacgaccactgcatcgacaccgttgttaacgaactgggtatcccgaaacgtaccctgtaccaccgtatcaaactgctgaacgttgctgctcgtggtctgtaataa BBa_K1014016_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgaccatccgtaactctaacgaatctgttcagtctctgcactgcgcttctcacgaatcttctctgacccacccgtctgaagacatccacggttctctgtcttctctgatccacaccatcgctccgctgaacgttgacatcgttctggaaggtgaaaccggtaccggtaaagacaccctggctcgtcgtatccaccagctgtctggttgcgctggtccgctggttgctgttaactgcgctgctgttccggaaaccctggctgaatctgaactgttcggtgttgtttctggtgcttacaccggtgcttctcgttctcgtgctggttacctggaaaccgctgacaaaggtatcctgttcctggacgaaatcgactctatgccgctgaccctgcaagctaaaatgctgcgtgttctggaatctcgtggtatcgaacgtctgggttctacccagttcaaaccggttgacatgcgtgttatcgttgctacccagaccccgctgcaaaaactggttgacgaaggtcgtttccgtcgtgacctgtacttccgtctggacaccgttaaaatccagctgccgaccctgcgttctcgtaccgaaatcatcctgccgctgttcgaacgtttcctgctggaagcttctgctcgtctgaaacgtccggctccgggtctgtctgctatcatccaggaacagctgctgatgcacggttggccgggtaacatccgtgaactgaaagctgctgctgaacgttgggttctgggtctgtctccggttccgatcgcttctgacggtgacgttcaggttatgggtgaagacaccccgctgacctctctgaaagttcgtctgcgtcgtatagagaggttcctgatccaggaggctctgcaacgtaacgaccactgcatcgacaccgttgttaacgaactgggtatcccgaaacgtaccctgtaccaccgtatcaaactgctgaacgttgctgctcgtggtctgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z