BBa_K1015000 1 BBa_K1015000 lacA-homology sequence(for RED recombination system) 2013-09-14T11:00:00Z 2015-05-08T01:08:42Z CGGAAGTCATGTGGTTATTAATCCAGGCGTCACCAT This sequence is 36bp homologous sequence with Escherichia coli lacA gene. Bacteriophage λ recombination system(RED system) can cause homologous recombination between this sequence and lacA gene. Because of the recombination, Biobrick part can insert into E.coli genome. false false _1321_ 0 15618 9 Not in stock false Genome insertion false Kento Tominaga annotation2343703 1 lacA homology sequence range2343703 1 1 36 BBa_K1015000_sequence 1 cggaagtcatgtggttattaatccaggcgtcaccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z