BBa_K1015007 1 BBa_K1015007 araC homology sequence (for RED recombination system) 2013-09-15T11:00:00Z 2015-05-08T01:08:42Z Escherichia coli MG1655 araC gene This sequence is homologous sequence with Escherichia coli araC gene. Bacterio phage λ recombination system(RED system) can cause homologous recombination between this sequence and araC gene. Because of the recombination, Biobrick part can be inserted into E. coli genome. false false _1321_ 0 15618 9 Not in stock false Genome insertion false Kento Tominaga annotation2346364 1 araA-homology sequence range2346364 1 1 40 BBa_K1015007_sequence 1 cgtcgctaagtagccgcatccggtatgtaacgcctgatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z