BBa_K1015011 1 BBa_K1015011 lacI-homology sequence 2013-09-15T11:00:00Z 2015-05-08T01:08:42Z Escherichia coli K18 This sequence is 36bp homologous sequence with Escherichia coli lacI gene. Bacteriophage λ recombination system(RED system) can cause homologous recombination between this sequence and lacI gene. Because of the recombination, Biobrick part can be inserted into E.coli genome. false false _1321_ 0 15618 9 Not in stock false Genome insertion false Kento Tominaga BBa_K1015011_sequence 1 gcgcaacgcaattaatgtgagttagctcactcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z