BBa_K1015018 1 BBa_K1015018 R(SaApR) 2013-09-15T11:00:00Z 2015-05-08T01:08:43Z pI258 plasmid Ampicillin resistance gene homology sequence. false false _1321_ 0 15618 9 Not in stock false genome insertion false Kento Tominaga annotation2353958 1 Ap resistance homology site range2353958 1 1 34 BBa_K1015018_sequence 1 aactgattttccctctattattttcgagatttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z