BBa_K1017404 1 BBa_K1017404 sRNA-2 2013-09-11T11:00:00Z 2015-05-08T01:08:43Z synthesis small RNA false false _1323_ 0 17894 9 In stock true N.A. false Wen-Hui Cheng annotation2362530 1 sRNA-2 range2362530 1 1 81 BBa_K1017404_sequence 1 gactcgagtacccctcatgcgacatccatttggctgaatattttagccgccccagtcagtaatgactggggcgttttttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z