BBa_K1019000 1 FimB FimB: positive regulator of type I fimbriae 2013-09-15T11:00:00Z 2015-05-08T01:08:43Z E. coli MG1655 Genome "FimB, along with FimE, is a recombinase in Escherichia coli which catalyzes the site-specific recombination required for inversion of a 314-bp invertible DNA element, the fim switch (fimS), to control transcription of the type I fimbrial structural genes--a process known as phase-variation switching. fimS contains the promoter for expression of the fimbrial structural genes. The promoter is positioned to allow expression of fimAICDFGH when fimS is in the ON orientation, but not when it is in the OFF orientation. FimB is responsible for both OFF-to-ON and ON-to-OFF switching at equal rates. FimE is responsible for primarily ON-to-OFF switching." (http://ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG10309) false false _1326_ 0 17886 9 It's complicated false The gene was isolated using PCR and cloned into our expression vector pEBS where it is under inducible control via the lac promoter. false Boris Dyakov annotation2365275 1 START range2365275 1 1 3 annotation2365276 1 STOP range2365276 1 601 603 BBa_K1019000_sequence 1 atgaagaataaggctgataacaaaaaaaggaacttcctgacccatagtgaaatcgaatcactccttaaagcagcaaataccgggcctcatgcagcacgtaattattgtctgactttgctttgttttattcatggtttccgggcgagtgaaatttgtcgattgaggatttcggatattgatcttaaggcaaagtgtatatatatccatcgattaaaaaaaggcttttcaacaacgcacccgctattgaataaagaagttcaggctttaaaaaactggttgagtatccgtacttcgtacccgcatgctgagagcgagtgggtatttttatcacgtaaggggaatccgctttctcggcaacagttttaccatattatctcgacttccggtggtaatgccgggttgtcactggagattcatccgcacatgttacgccattcgtgtggttttgctttggcgaatatgggaatagatacgcgacttatccaggattatcttgggcatcgcaatattcgtcatactgtctggtataccgccagcaatgcagggcgtttttacggcatctgggatagagccagaggacgacagcgtcacgctgttttatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z