BBa_K1019001 1 CsgD CsgD: positive regulator of curlin genes 2013-09-15T11:00:00Z 2015-05-08T01:08:43Z E. coli K-12 MG1655 "The protein CsgD, for "Curlin subunit gene D," is a transcriptional regulator [Hammar95] that regulates a number of genes involved in the Curli assembly, transport, and structural components [Loferer97, Hammar95], which are important for biofilm formation [Brombacher03]. In addition, it also regulates genes related to cell surface-associated structures [Brombacher03, Gualdi08, Brombacher06]. It may also have the capability to respond to starvation and high cell density [Brombacher03] and positively controls &#963;S expression [Bougdour06, Gualdi07]. In general the environmental conditions, such as low osmolarity, low growth temperature (<32??C), and low growth, affect the expression of csgD and the production of the biofilm and cellulose [Gualdi08, PrigentCom01, Olsen93a]. Since csgD is induced during the mid-exponential phase of growth and the CsgD-dependent activation of csg genes is detected in the stationary phase, it has been suggested that CsgD is posttranscriptionally activated in the stationary phase [Brombacher03]. CsgD might activate transcription through two different mechanisms, as suggested by the different locations of its binding sites in the regulatory regions of the genes it activates. In one regulatory region, the protein binds to a single site, whereas it binds to two sites arranged as inverted repeats in another region [Brombacher03]. CsgD belongs to the FixJ/LuxR/UhpA family, which is characterized by a C-terminal domain that contains a potential helix-turn-helix DNA-binding motif and a receiver domain in the N-terminal region [Volz93]. Five different small RNAs are known to regulate expression of CsgD at the post-transcriptional level; reviewed in [Boehm12]. Gene Citations: [Ogasawara07a, Neidhardt96]" (http://ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=G6546) false false _1326_ 0 17886 9 In stock false The gene was isolated using PCR and cloned into our expression vector pEBS where it is under inducible control via the lac promoter. false Boris Dyakov BBa_K1019001_sequence 1 atgtttaatgaagtccatagtattcatggtcatacattattgttgatcactaaatcttctttgcaggcgacagctctcttgcagcaccttaaacaatcgctggcaattacaggaaaattacataatattcaacgttctctggacgatatctcttcaggctctattattcttctggatatgatggaagcggataaaaagcttatccattattggcaggatactttgagcaggaaaaacaacaatatcaaaatattgttgctaaatacgcctgaagattacccgtaccgcgacattgaaaactggcctcatatcaacggcgttttttattccatggaggatcaagaacgtgttgtcaatgggttgcaaggcgtcctgcgcggcgaatgctactttacgcaaaagcttgccagctacctgattacgcattcaggtaactatcgttataacagcacggaatcagccctccttactcatcgggaaaaagagatcctgaataagctgcgtatcggcgcgtctaataacgagatcgctcgttcgttgttcatcagcgaaaatacggttaaaacgcatctttataatcttttcaagaagatagccgtaaaaaaccggacacaagcggtttcctgggcaaacgataacctcaggcgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z