BBa_K1020002 1 BBa_K1020002 alkane regulatory protein ALKR 2013-08-17T11:00:00Z 2015-05-08T01:08:43Z Acinetobacter baylyi ADP1 AlkR is a transcriptional regulator belonging to AraC/Xyls family, which could detect a broad range of alkanes and alkenes with carbon chain length from C7 to C36. It is said that AlkR is the only bioreporter that is able to detect alkane with carbon chain length greater than C18. false false _1327_ 0 16881 9 Not in stock false false Yue Liu annotation2331899 1 AlkR range2331899 1 1 927 BBa_J23103 1 BBa_J23103 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1020003 1 BBa_K1020003 AlkR -PSB1C3-Low constitutive 2013-08-17T11:00:00Z 2015-05-08T01:08:43Z Acinetobacter baylyi ADP1 AlkR is a transcriptional regulator belonging to AraC/Xyls family, which could detect a broad range of alkanes and alkenes with carbon chain length from C7 to C36. It is said that AlkR is the only bioreporter that is able to detect alkane with carbon chain length greater than C18. The mechanism is that alkanes are presumably recognized by AlkR regulatory protein and their interaction triggered a conformation change of AlkR dimers which isomerizes the promoter-RNAP complex and lead to the activation of alkM gene. AlkR regulatory protein includes C-terminal DNA-binding domain(CTD) for promoter binding and N-terminal domain(NTD) for inducer recognition. Here we use a constitutive promoter for AlkR gene and in case of interference, we choose a long and strong terminator. false false _1327_ 0 16881 9 It's complicated false We use a constitutive promoter for AlkR gene and we choose a long and strong terminator to prevent interference. false Yue Liu component2333548 1 BBa_B0015 component2333541 1 BBa_K1020002 component2333539 1 BBa_B0034 component2333537 1 BBa_J23103 annotation2333539 1 BBa_B0034 range2333539 1 44 55 annotation2333548 1 BBa_B0015 range2333548 1 997 1125 annotation2333541 1 BBa_K1020002 range2333541 1 62 988 annotation2333537 1 BBa_J23103 range2333537 1 1 35 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23103_sequence 1 ctgatagctagctcagtcctagggattatgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1020002_sequence 1 atggatgcacttagtaaaatttttgatgatattcatttaaataaatctgaatatctctatgtaaaaactcaaggagaatgggcatttcatatgcttgcccaagatgctttgattgctcacattattttaatgggttctgctcatttcacattacaggatggtacgacacaaaccgcttattcgggagatattgtgcttattccttctgggcaagctcattttgtctcaaatgatgctcagaacaaactaattgattgttccaacattcagtctttttttgatggacaccgcaatgatgccattgagttaggcacaacatcttcggatcatggtttaatttttactgtgcggagccatatcgatatgcatatgggtagccctttactcaatgctttaccatcactgatacatattcatcacgcaatgagctcaactggcccagagtggttacgcgtcggtttatattttgtggcacttgaaacccagcgtattcaaccaggacgagataaaatatttgaccacttgatgagcatcctatttatagaatgtgtccgcgatcatattgcccagcttgatgaccccaaaagctggttaactgcactcatgcatcccgaattatctaatgcgctcgcagctattcatgcttaccccgaaaaaccttggactgtagagagtttggcagatcaatgttgcatgtcacggtctaaatttgccacactttttcaaagtattgttcatgagacccctctcgcttatcttcaacaacatcgccttcgtctggccgtacagttattaaaaaccagtcagttaaatattcagcaaattgccaataaagtcggatactcctcagaaacagcttttagtcaggcatttaaacgtcaatttgaacaatctcctaaacactatcgccagcaatcatgataataa BBa_K1020003_sequence 1 ctgatagctagctcagtcctagggattatgctagctactagagaaagaggagaaatactagatggatgcacttagtaaaatttttgatgatattcatttaaataaatctgaatatctctatgtaaaaactcaaggagaatgggcatttcatatgcttgcccaagatgctttgattgctcacattattttaatgggttctgctcatttcacattacaggatggtacgacacaaaccgcttattcgggagatattgtgcttattccttctgggcaagctcattttgtctcaaatgatgctcagaacaaactaattgattgttccaacattcagtctttttttgatggacaccgcaatgatgccattgagttaggcacaacatcttcggatcatggtttaatttttactgtgcggagccatatcgatatgcatatgggtagccctttactcaatgctttaccatcactgatacatattcatcacgcaatgagctcaactggcccagagtggttacgcgtcggtttatattttgtggcacttgaaacccagcgtattcaaccaggacgagataaaatatttgaccacttgatgagcatcctatttatagaatgtgtccgcgatcatattgcccagcttgatgaccccaaaagctggttaactgcactcatgcatcccgaattatctaatgcgctcgcagctattcatgcttaccccgaaaaaccttggactgtagagagtttggcagatcaatgttgcatgtcacggtctaaatttgccacactttttcaaagtattgttcatgagacccctctcgcttatcttcaacaacatcgccttcgtctggccgtacagttattaaaaaccagtcagttaaatattcagcaaattgccaataaagtcggatactcctcagaaacagcttttagtcaggcatttaaacgtcaatttgaacaatctcctaaacactatcgccagcaatcatgataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z