BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1020007 1 BBa_K1020007 AlkR -PSB1C3-High constitutive 2013-09-09T11:00:00Z 2015-05-08T01:08:43Z Acinetobacter baylyi ADP1 AlkR is a transcriptional regulator belonging to AraC/Xyls family, which could detect a broad range of alkanes and alkenes with carbon chain length from C7 to C36. It is said that AlkR is the only bioreporter that is able to detect alkane with carbon chain length greater than C18. false false _1327_ 0 16881 9 It's complicated false AlkR with strong promoter and terminator. false Yue Liu component2338167 1 BBa_B0034 component2338176 1 BBa_B0015 component2338169 1 BBa_K1020002 component2338165 1 BBa_J23100 annotation2338169 1 BBa_K1020002 range2338169 1 62 988 annotation2338167 1 BBa_B0034 range2338167 1 44 55 annotation2338176 1 BBa_B0015 range2338176 1 997 1125 annotation2338165 1 BBa_J23100 range2338165 1 1 35 BBa_K1020002 1 BBa_K1020002 alkane regulatory protein ALKR 2013-08-17T11:00:00Z 2015-05-08T01:08:43Z Acinetobacter baylyi ADP1 AlkR is a transcriptional regulator belonging to AraC/Xyls family, which could detect a broad range of alkanes and alkenes with carbon chain length from C7 to C36. It is said that AlkR is the only bioreporter that is able to detect alkane with carbon chain length greater than C18. false false _1327_ 0 16881 9 Not in stock false false Yue Liu annotation2331899 1 AlkR range2331899 1 1 927 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1020002_sequence 1 atggatgcacttagtaaaatttttgatgatattcatttaaataaatctgaatatctctatgtaaaaactcaaggagaatgggcatttcatatgcttgcccaagatgctttgattgctcacattattttaatgggttctgctcatttcacattacaggatggtacgacacaaaccgcttattcgggagatattgtgcttattccttctgggcaagctcattttgtctcaaatgatgctcagaacaaactaattgattgttccaacattcagtctttttttgatggacaccgcaatgatgccattgagttaggcacaacatcttcggatcatggtttaatttttactgtgcggagccatatcgatatgcatatgggtagccctttactcaatgctttaccatcactgatacatattcatcacgcaatgagctcaactggcccagagtggttacgcgtcggtttatattttgtggcacttgaaacccagcgtattcaaccaggacgagataaaatatttgaccacttgatgagcatcctatttatagaatgtgtccgcgatcatattgcccagcttgatgaccccaaaagctggttaactgcactcatgcatcccgaattatctaatgcgctcgcagctattcatgcttaccccgaaaaaccttggactgtagagagtttggcagatcaatgttgcatgtcacggtctaaatttgccacactttttcaaagtattgttcatgagacccctctcgcttatcttcaacaacatcgccttcgtctggccgtacagttattaaaaaccagtcagttaaatattcagcaaattgccaataaagtcggatactcctcagaaacagcttttagtcaggcatttaaacgtcaatttgaacaatctcctaaacactatcgccagcaatcatgataataa BBa_K1020007_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatggatgcacttagtaaaatttttgatgatattcatttaaataaatctgaatatctctatgtaaaaactcaaggagaatgggcatttcatatgcttgcccaagatgctttgattgctcacattattttaatgggttctgctcatttcacattacaggatggtacgacacaaaccgcttattcgggagatattgtgcttattccttctgggcaagctcattttgtctcaaatgatgctcagaacaaactaattgattgttccaacattcagtctttttttgatggacaccgcaatgatgccattgagttaggcacaacatcttcggatcatggtttaatttttactgtgcggagccatatcgatatgcatatgggtagccctttactcaatgctttaccatcactgatacatattcatcacgcaatgagctcaactggcccagagtggttacgcgtcggtttatattttgtggcacttgaaacccagcgtattcaaccaggacgagataaaatatttgaccacttgatgagcatcctatttatagaatgtgtccgcgatcatattgcccagcttgatgaccccaaaagctggttaactgcactcatgcatcccgaattatctaatgcgctcgcagctattcatgcttaccccgaaaaaccttggactgtagagagtttggcagatcaatgttgcatgtcacggtctaaatttgccacactttttcaaagtattgttcatgagacccctctcgcttatcttcaacaacatcgccttcgtctggccgtacagttattaaaaaccagtcagttaaatattcagcaaattgccaataaagtcggatactcctcagaaacagcttttagtcaggcatttaaacgtcaatttgaacaatctcctaaacactatcgccagcaatcatgataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z