BBa_K1021012 1 BBa_K1021012 G. lucidum long left homology region 2013-09-12T11:00:00Z 2015-05-08T01:08:44Z It comes from the genome of Ganoderma lucidum 10597 SS-1, from the lab of David Hibbett at Clark University. This can be used for homologous recombination with the glyceraldehyde 3-phosphate dehydrogenase gene in Ganoderma lucidum. false false _1328_ 0 13516 9 In stock false We had to amplify this short genomic sequence directly from the fungal genome. false Swati Sureka annotation2340225 1 G. lucidum L_hom_long range2340225 1 1 200 BBa_K1021012_sequence 1 atgcccgtgagtagatgacttccgttcctcttgcggcggattgaccgtactggtacttctaggtcaaagtcggaattaacgggtaagccgtggattggaatgccatgtcacgaggagttattctgaccatttgtatactccttctctagcttcggtgagcgatacgcttcgtatgtaggctctcaggtgcttacatgaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z