BBa_K1025000 1 BBa_K1025000 mut part 2013-09-06T11:00:00Z 2015-05-08T01:08:45Z The gene comes from genome of E.coli W3110,but it has two amino acid mutation. iGEMmut part is a plasmid constructed by 2013 iGEM Tsinghua-E team which is used for genome level in vivo high-diversity library construction. In this vector, highly error-prone dnaQ mutant, mutD1 was cloned downstream of araBAD promoter so that we can control the mutation intensity of the target genome by the change of the concentration of araBAD promoter???s inducer, L-arabinose. Actually, we measured the mutation increase induced by our mut part with the protocol described in our note from (website citation). To be brief, by measuring the reversion of rifampinresistance caused by mutation in genome, we accurately determined the mutation rate increase to be as big as times compared with negative control. The data is shown below. After the test, we successfully applied our mut part in our iGEM tryptophan overproduction evolution project and obtained a titer increase from to. false false _1332_ 0 18748 9 Not in stock false No false Weifan Liang annotation2335284 1 mutD range2335284 1 1 732 BBa_K1025000_sequence 1 atgagcactgcaattacacgccagatcgttctcgataccgaaaccaccggtatgaaccagattggtgcgcactatgaaggccacaagatcattgagattggtgccgttgaagtggtgaaccgtcgcctgacgggcaataacttccatgtttatctcaaaccggatcggctggtggatccggaagcctttggcgtacatggtattgccgatgaattttggctcgataagccgacgtttgccgaagtagccgatgagttcatggactatatccgcggcgcggagttggtgatccataacgcagcgttcgatatcggctttatggactacgagttttcgttgcttaagcgcgatattccgaagaccaataccttctgtaaggtcaccgatagccttgcggtggcgcggaaaatgtttcctggtaagcgcaacagcctcgatgcgttatgtgcccgctacgaaattgataacagtaaacgtacgctgcacggggtattactcgatgcccagatccttgcggaagtttatctggcgatgaccggtggtcaaacgtcgatggcttttgcgatggaaggagagacacaacagcaacaaggtgaagcaacaattcagcgcattgtacgtcaggcaagtaagttacgcgttgtttttgcgacagatgacgagcttgcagcacatgaagcccgtcttgatctggtgcagaagaagggcggaagctgcctctggcgggcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z