BBa_K1025001 1 BBa_K1025001 araBAD promoter 2013-09-06T11:00:00Z 2015-05-08T01:08:45Z The part comes from pRedET plasmid. The part is araBAD promoter,induced by L-arabinose. false false _1332_ 0 18748 9 Not in stock false We use the plasmid backbone,and add our genes downstream the this promoter. false Weifan Liang annotation2335362 1 araBAD promoter range2335362 1 1 289 BBa_K1025001_sequence 1 agaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcttacctgacgctttttatcgcaactctctactgtttctccatacccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z