BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1026002 1 Const gR4m Constitutively Expressed gRNA targeting mRFP 2013-09-15T11:00:00Z 2015-05-08T01:08:46Z The gRNA sequence is de novo synthesized. This Constitutively Expressed gRNA targeting mRFP is a no-BioBrick-scars assembly of the constitutive promoter BBa_J23100, DNA sequence of a gRNA that targets mRFP reporter and a reliable terminator BBa_B0015. This gRNA sequence comes from the following literature: QI, LEI S., LARSON, MATTHEW H., GILBERT, LUKE A., DOUDNA, JENNIFER A., WEISSMAN, JONATHAN S., ARKIN, ADAM P. & LIM, WENDELL A. 2013. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell, 152, 1173-1183. false false _1333_ 0 12098 9 It's complicated true gRNA shall be exactly transcribed out. Any extra nucleotides would potentially jeopardize the normal function of the gRNA. Therefore, BioBrick scars are not allowed here. Instead of cut-and-ligation, inverse PCR or In-Fusion is preferred for the assembly task. In addition, a reliable terminator is applied here to ensure the termination of gRNA. false Hongyi WU component2347374 1 BBa_J23100 component2347375 1 BBa_K1026003 component2347382 1 BBa_B0015 annotation2347374 1 BBa_J23100 range2347374 1 1 35 annotation2347382 1 BBa_B0015 range2347382 1 138 266 annotation2347375 1 BBa_K1026003 range2347375 1 36 137 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1026003 1 BBa_K1026003 gRNA targeting mRFP 2013-09-15T11:00:00Z 2015-05-08T01:08:46Z The gRNA sequence is de novo synthesized. A gRNA that targets mRFP reporter. This gRNA sequence comes from the following literature: QI, LEI S., LARSON, MATTHEW H., GILBERT, LUKE A., DOUDNA, JENNIFER A., WEISSMAN, JONATHAN S., ARKIN, ADAM P. & LIM, WENDELL A. 2013. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell, 152, 1173-1183. false false _1333_ 0 12098 9 Not in stock false Criteria for designing a gRNA in CRISPRi are illustrated in the above literature. false Hongyi WU BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1026002_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcaactttcagtttagcggtctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1026003_sequence 1 aactttcagtttagcggtctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z