BBa_K1026003 1 BBa_K1026003 gRNA targeting mRFP 2013-09-15T11:00:00Z 2015-05-08T01:08:46Z The gRNA sequence is de novo synthesized. A gRNA that targets mRFP reporter. This gRNA sequence comes from the following literature: QI, LEI S., LARSON, MATTHEW H., GILBERT, LUKE A., DOUDNA, JENNIFER A., WEISSMAN, JONATHAN S., ARKIN, ADAM P. & LIM, WENDELL A. 2013. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell, 152, 1173-1183. false false _1333_ 0 12098 9 Not in stock false Criteria for designing a gRNA in CRISPRi are illustrated in the above literature. false Hongyi WU BBa_K1026003_sequence 1 aactttcagtttagcggtctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z