BBa_K1026009 1 BBa_K1026009 A rationally designed promoter negative regulated by CcaR 2013-09-26T11:00:00Z 2015-05-08T01:08:46Z Synechocystissp. PCC 6803 By fusing G-box, a region that CcaR binds, with the constitutive promoter, BBa_J23107, we devised a promoter that is constitutive without active CcaR (the transcription factor in green light sensor system, CcaS-CcaR-PcpcG2), but be inhibited when CcaR is activated by green light. false false _1333_ 0 12098 9 Not in stock true We discovered a segment around the -35 region of BBa_J23107 that is almost identical to G-box, the binding region of CcaR on PcpcG2. So we put the G-box onto this exact region, between -35 region and -10 region of the original promoter. Therefore, we expect that activated CcaR will bind and hinder RNA polymerase binding, and thus prevents transcription initialization. false Hongyi WU BBa_K1026009_sequence 1 ctttccgatttctttacgattttctccgccctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z