BBa_K1026010 1 Blue gR4mR A gRNA targeting mRFP, negatively regulated by Blue Light Sensor 2013-09-26T11:00:00Z 2015-05-08T01:08:46Z The gRNA sequence is de novo synthesized. This gRNA targeting mRFP is a no-BioBrick-scars assembly of the red light regulated promoter BBa_K592006 (PFixK2), DNA sequence of a gRNA that targets mRFP reporter and a reliable terminator BBa_B0015. This gRNA sequence comes from the following literature: QI, LEI S., LARSON, MATTHEW H., GILBERT, LUKE A., DOUDNA, JENNIFER A., WEISSMAN, JONATHAN S., ARKIN, ADAM P. & LIM, WENDELL A. 2013. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell, 152, 1173-1183. false false _1333_ 0 12098 9 Not in stock true gRNA shall be exactly transcribed out. Any extra nucleotides would potentially jeopardize the normal function of the gRNA. Therefore, BioBrick scars are not allowed here. Instead of cut-and-ligation, overlap PCR is preferred for the assembly task (changing promoter). In addition, a reliable terminator is applied here to ensure the termination of gRNA. false Hongyi WU component2371338 1 BBa_K1026003 component2371337 1 BBa_K592006 component2371345 1 BBa_B0015 annotation2371338 1 BBa_K1026003 range2371338 1 259 360 annotation2371345 1 BBa_B0015 range2371345 1 369 497 annotation2371337 1 BBa_K592006 range2371337 1 1 250 BBa_K1026003 1 BBa_K1026003 gRNA targeting mRFP 2013-09-15T11:00:00Z 2015-05-08T01:08:46Z The gRNA sequence is de novo synthesized. A gRNA that targets mRFP reporter. This gRNA sequence comes from the following literature: QI, LEI S., LARSON, MATTHEW H., GILBERT, LUKE A., DOUDNA, JENNIFER A., WEISSMAN, JONATHAN S., ARKIN, ADAM P. & LIM, WENDELL A. 2013. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell, 152, 1173-1183. false false _1333_ 0 12098 9 Not in stock false Criteria for designing a gRNA in CRISPRi are illustrated in the above literature. false Hongyi WU BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K592006 1 BBa_K592006 FixK2 promoter 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z FixK2 promoter omes from the genome of Bradyrhizobium japonicum. Released HQ 2013 FixK2 promoter is the wild-type promoter to which phospho-FixJ binds. FixJ in turn can be regulated by YF1, the blue light-sensing protein. This promoter shows very little leaky activity in the absence of FixJ. false false _763_ 0 7929 9 In stock false The sequence information was provided by Moffat (Moffat et al. 2009). The DNA was synthesized by GenScript. false Lei Sun annotation2130179 1 FixK2 promoter range2130179 1 1 250 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1026010_sequence 1 gccggagccgattatccgcacccgtccttggtcttggacacactcgctcgcgatccgaagccgcctttcaaagatactccgcagtgaaacgcatcttttaagcgcgacttgtcgccttcgcgcagcagaacactcgtatggcactcaatccatgatcgcttcgttcgctccgacgcgcgttgcggggcccccctcgaccggatgacaacacattgcgtcacctcaactgctgcgcgcgcactgcgtcacatactagagaactttcagtttagcggtctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K592006_sequence 1 gccggagccgattatccgcacccgtccttggtcttggacacactcgctcgcgatccgaagccgcctttcaaagatactccgcagtgaaacgcatcttttaagcgcgacttgtcgccttcgcgcagcagaacactcgtatggcactcaatccatgatcgcttcgttcgctccgacgcgcgttgcggggcccccctcgaccggatgacaacacattgcgtcacctcaactgctgcgcgcgcactgcgtcaca BBa_K1026003_sequence 1 aactttcagtttagcggtctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z