BBa_K1026014 1 BBa_K1026014 Constitutively Expressed pcyA Operon 2013-09-15T11:00:00Z 2015-05-08T01:08:46Z cyanobacteria pcyA Operon false false _1333_ 0 12098 9 It's complicated true pcyA Operon false Hongyi WU component2347452 1 BBa_J23100 component2347464 1 BBa_B0015 component2347457 1 BBa_I15009 component2347454 1 BBa_B0034 annotation2347457 1 BBa_I15009 range2347457 1 62 836 annotation2347454 1 BBa_B0034 range2347454 1 44 55 annotation2347452 1 BBa_J23100 range2347452 1 1 35 annotation2347464 1 BBa_B0015 range2347464 1 845 973 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I15009 1 BBa_I15009 phycocyanobilin:ferredoxin oxidoreductase (PcyA) from synechocystis 2004-09-19T11:00:00Z 2015-08-31T04:07:38Z Voigt Lab via Anselm Levskaya Released HQ 2013 Second of two required phycocyanobilin biosynthetic genes. false false _5_ 0 88 7 In stock true true Jeff Tabor annotation2214032 1 Help:Barcodes range2214032 1 751 775 annotation1891612 1 PcyA range1891612 1 1 750 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_I15009_sequence 1 atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1026014_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z