BBa_K1028000 1 Si4 Silica binding peptide 2013-08-29T11:00:00Z 2015-05-08T01:08:46Z This sequence is taken from the "Site-Specific Labeling of Surface Proteins on Living Cells Using Genetically Encoded Peptides that Bind Fluorescent Nanoparticle Probes" paper published by Rocco et al. This is a short peptide of 15 amino acids designed to bind with high affinity to silica and silica-like particles, designed as a tag to be attached to the C-terminus of polypeptides. This part was originally designed to be conjugated to the C-terminal of Ice Nucleation Protein allowing extracellular expression of the binding region. false false _1335_ 0 15658 9 In stock false The sequence was codon optomised for E.Coli expression. false Oleg Karpov, Joseph Beton annotation2333674 1 Coding region range2333674 1 1 45 annotation2333673 1 stop codon range2333673 1 49 49 annotation2333672 1 stop codon range2333672 1 46 46 BBa_K1028000_sequence 1 ggcggtgggactcatcaccatcgccctcatccacatccgtcgatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z