BBa_K135000 1 BBa_K135000 pCpxR (CpxR responsive promoter) 2008-10-19T11:00:00Z 2015-05-08T01:10:01Z This part comes from the genome of E.coli TR235, as used in the PNAS paper of Otto and Silhavy mentioned previously. TR235 is K-12 MC4100 containing a pCpxR-LacZ fusion inserted at the (Lambda)att site, plus some other modifications (see Otto and Silhavy). The part is a portion of the CpxR responsive region used in these LacZ fusions. This is suggested to be an adhesion responsive promoter. It contains the binding site for CpxR-P (phosphorylated CpxR). CpxR is one member of the two-component Cpx response to envelope stress. Briefly, envelope stress causes CpxA, an inner-membrane histidine Kinase to Phosphorylate CpxR, allowing it to bind to CpxR-P responsive regions and regulate downstream target genes. See 'Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway', Karen Otto and Thomas J. Silhavy, PNAS, Vol. 99., No, 4., 2287-2292. 2002. false false _183_ 0 2796 9 It's complicated false None false Oliver Purcell annotation1982751 1 CpxR-P Binding site range1982751 1 1 15 annotation1982752 1 BBa_K135000 range1982752 1 1 55 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_K1028002 1 BBa_K1028002 A cell membrane stress reporter gene 2013-09-18T11:00:00Z 2015-05-08T01:08:46Z The parts for this were aquired from the iGEM 2013 delivery plates. The CpxR promoter is activated via adhesion of the cellular membrane to hydrophobic surfaces, with GFP downstream of the promoter the gene functions to produce a visible and quantitive signal upon surface binding. false false _1335_ 0 15658 9 It's complicated false The parts were assembled using PCR assembly to avoid introducing a scar site between the promoter and the ribosome binding site included in part BBa_K081012 and in assembled parallel false Joseph Beton component2355487 1 BBa_K081012 component2355476 1 BBa_K135000 annotation2355487 1 BBa_K081012 range2355487 1 64 851 annotation2355476 1 BBa_K135000 range2355476 1 1 55 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K081012 1 BBa_K081012 GFP protein generator - PoPS->GFP 2008-10-17T11:00:00Z 2015-05-08T01:08:35Z RBS: GFP: T: Released HQ 2013 PoPS in -> GFP out <br> Strong RBS (efficiency=0.6). false false _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component1981957 1 BBa_E0040 component1981962 1 BBa_B1006 component1981954 1 BBa_B0030 annotation1981954 1 BBa_B0030 range1981954 1 1 15 annotation1981957 1 BBa_E0040 range1981957 1 22 741 annotation1981962 1 BBa_B1006 range1981962 1 750 788 BBa_K081012_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K1028002_sequence 1 gtaaaacaacgtaaagtcatggattagcgacgtctgatgacgtaatttctgcctctactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_B0030_sequence 1 attaaagaggagaaa BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K135000_sequence 1 gtaaaacaacgtaaagtcatggattagcgacgtctgatgacgtaatttctgcctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z