BBa_K102900 1 BBa_K102900 TA0 null terminator 2008-10-23T11:00:00Z 2015-05-08T01:08:46Z Synthetic TA0 is a null terminator with minimal secondary structure (energy = -7.1 kCal/mole). It is used to represent a TRUE (always ON) gate and should give the maximum output possible. false false _181_ 0 2647 9 Not in stock false Gate is flanked by BamHI and NcoI to facilitate simple replacement in output test harness. Because gates are fairly long duplex DNA strands, a single strand can be ordered and the dsDNA created by PCR using Term+ (5'cgatcagaattcgcggcc) and Term- (5'GGACATCTGCAGCGGCCG) primers. false Wayne Materi BBa_K102900_sequence 1 caatagatcattgggatccgaagcccccggaagatgcatcgtcagatagcaacgcgccgccatggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z