BBa_K102901 1 BBa_K102901 TA1 (THRU gate) 2008-10-23T11:00:00Z 2015-05-08T01:08:46Z (Larson et al, 2008) TA1 is based on the canonical his terminator (Larson et al, 2008) with all U's at the 3' tail. false false _181_ 0 2647 9 Not in stock true Gate is flanked by BamHI and NcoI to facilitate simple replacement in output test harness. Because gates are fairly long duplex DNA strands, a single strand can be ordered and the dsDNA created by PCR using Term+ (5'cgatcagaattcgcggcc) and Term- (5'GGACATCTGCAGCGGCCG) primers. false Wayne Materi annotation1986806 1 his term range1986806 1 19 58 BBa_K102901_sequence 1 aatagatcattgggatccgaagcccccggaagatgcatcttccgggggctttttttttccatggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z