BBa_K102907 1 BBa_K102907 TA9 gate from synthetic algorithm v1.1 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z Synthetic TA9 is TA1 (see BBa_K102901) with a "pause" sequence (Isaacs et al., 2004) at the 3' end of the stem-loop and a corresponding complementary sequence at the 5' end. false false _181_ 0 2647 9 Not in stock false See Team wiki (2008 Alberta_NINT) Project page for description of algorithm. false Wayne Materi annotation1988466 1 TA9 stem-loop range1988466 1 20 68 BBa_K102907_sequence 1 caatagatcattgggatccgaagagcacacatcccccggaagatgcatcttccgggggatgtgtgctctttttttttccatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z