BBa_K102908 1 BBa_K102908 TA10 gate from synthetic algorithm v1.1 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z Synthetic The TA10 gate is a synthetic terminator with a 3' pause (Isaacs et al, 2004) sequence. false false _181_ 0 2647 9 Not in stock false See Team wiki (2008 Alberta_NINT) Project page for description of algorithm. false Wayne Materi annotation1988468 1 TA10 stem-loop range1988468 1 19 81 BBa_K102908_sequence 1 caatagatcattgggatccagcacacatccctaggtccggccctggtaaaaaaccagggccggacctagggatgtgtgctgtttttttttccatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z