BBa_K102950 1 BBa_K102950 TA0In null anti-sense input 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z Synthetic From synthetic algorithm v1.1. This is a null input device which should not be complementary to any gate stem-loop structure. false false _181_ 0 2647 9 Not in stock false See Team wiki (2008 Alberta_NINT) Project page for description of algorithm. false Wayne Materi annotation1990312 1 hammerhead ribozyme 1 range1990312 1 13 76 annotation1990314 1 hammerhead ribozyme 2 range1990314 1 115 175 annotation1990313 1 TA0In RNA range1990313 1 77 109 BBa_K102950_sequence 1 ggagggatcattgtcgagctctgatgagtccgtgaggacgaaacggtagacagtaccgtcagctcgacaagctttcgctatctttttcgtgacattcagttcgattactaactactcgagatccgtcgaccagtcatgcctggtcctgatgagtccgtgaggacgaaacggatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z