BBa_K102953 1 BBa_K102953 TA13n anti-sense input to TA3 (BBa_K102903) 2008-10-25T11:00:00Z 2015-05-08T01:08:46Z Synthetic This provides the anti-sense input to disrupt (and thereby activate) the TA3 gate (BBa_K102903). Tha actual transcript includes two flanking hammerhead ribozymes (Taira et al, 1991) which self-cleave to release the anti-sense RNA. false false _181_ 0 2647 9 Not in stock false See Team wiki (2008 Alberta_NINT) Project page for description of algorithm. false Wayne Materi annotation1990331 1 TA3In anti-sense range1990331 1 77 104 BBa_K102953_sequence 1 ggagggatcattgtcgagctctgatgagtccgtgaggacgaaacggtagacagtaccgtcagctcgacaagctttcgcgtttttcgcgggcccggacctgggaactactcgagatccgtcgaccagtcatgcctggtcctgatgagtccgtgaggacgaaacggatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z