BBa_K1033115 1 BBa_K1033115 Histidine Patch Thioredoxin 2013-09-16T11:00:00Z 2015-05-08T01:08:49Z E.coli This is a mutant of E. coli's native thioredoxin. It has been modified to have the ability to chelate metal ions, notably nickel. This protein is useful as a fusion protein which can help to increase the solubility of difficult-to-express proteins and maximize yield of those proteins. Please note that this protein does not have a stop codon, to aid in its use as a fusion protein. false false _1340_ 0 13997 9 It's complicated false This construct was synthesized as a gblock by Integrated DNA Technologies (IDT) and then cloned into pSB1C3 false Sabri Jamal annotation2351904 1 BBa_B0034 range2351904 1 1 12 annotation2351905 1 Thioredoxin range2351905 1 19 354 annotation2351903 1 conserved range2351903 1 5 8 BBa_K1033115_sequence 1 aaagaggagaaatacaacatgggatctgataaaattattcatctgactgatgattcttttgatactgatgtacttaaggcagatggtgcaatcctggttgatttctgggcacactggtgcggtccgtgcaaaatgatcgctccgattctggatgaaatcgctgacgaatatcagggcaaactgaccgttgcaaaactgaacatcgatcacaacccgggcactgcgccgaaatatggcatccgtggtatcccgactctgctgctgttcaaaaacggtgaagtggcggcaaccaaagtgggtgcactgtctaaaggtcagttgaaagagttcctcgacgctaacctggccggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z