BBa_K1033219 1 BBa_K1033219 Promoter CP1 2013-08-22T11:00:00Z 2015-05-08T01:08:49Z This part is a synthetic promoter based on a promoter library from the article "The Sequence of Spacers between the Consensus Sequences Modulates the Strength of Prokaryotic Promoters." by Peter Ruhdal Jensen and Karin Hammer. This part codes for a promoter that works in both E. coli and L. bacillus. false false _1340_ 0 17260 9 In stock false This part is designed with the same sticky ends as you would get by cutting it with EcoRI-HF and Spel. false Stephanie Herman, Alona Nyberg BBa_K1033219_sequence 1 cataccggagtttattcttgacagttccacctcgggttgatataatatctcagtactgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z