BBa_K1033239 1 BBa_K1033239 Signal peptide from Lactobacillus reuteri collagen binding protein 2013-08-22T11:00:00Z 2015-05-08T01:08:49Z Isolated from the genome of Lactobacillus reuteri DSM 20016 [1] 1. http://www.uniprot.org/uniprot/P71482 The first 25 amino acids of the collagen binding protein from Lactobacillus reuteri DSM 20016 act as a tag that ensures that the protein is exported out of the cell and is a potential part of an ABC transporter system [1]. It can be fused together with other proteins with the Freiburg standard to export them out of the organism. 1. Roos S, Aleljung P, Robert N, Lee B, Wadstr??m T, Lindberg M, Jonsson H. (1996) A collagen binding protein from Lactobacillus reuteri is part of an ABC transporter system? false false _1340_ 0 18318 9 Not in stock false The part is designed according to the Freiburg [1] standard to enable fusion with other proteins. Only the 3' end designed according to this standard as a signal peptide always is fused to the 5' part of a protein. 1. http://parts.igem.org/Help:Assembly_standard_25 false Anton Berglund BBa_K1033239_sequence 1 aaagaggagaaatactagatgaaattttggaagaaagcactattaacaattgcagccttaacagtcggcacctccgcaggaattacaagcgtttctgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z