BBa_K1033250 1 BBa_K1033250 mCherry fusion protein codon optimised for Lactobacillus reuteri 2013-09-12T11:00:00Z 2015-05-08T01:08:49Z mCherry has originally been derived from a protein isolated from Discosoma sp. This part has been synthesised and codon optimised for Lactobacillus reuteri by Stefan Roos at SLU in Sweden. It was then biobricked by iGEM Uppsala 2013 according to fusion standard 25. mCherry is a very popular fluorescent protein. This version has been codon optimised for use in Lactobacillus reuteri and biobricked according to standard 25 to allow for the creation of fusion proteins. http://www.clontech.com/US/Products/Fluorescent_Proteins_and_Reporters/Fluorescent_Proteins_by_Name/mCherry_Fluorescent_Protein false false _1124_1340_ 0 14332 9 In stock false The gene is codon optimised for Lactobacillus reuteri but should work in a wide range of species in the lactobacillus genus. It has been modified according to assembly standard 25 to allow it to be used as a fusion protein. false Anders Edlund annotation2367766 1 mCherry range2367766 1 1 701 BBa_K1033250_sequence 1 atggtttctaagggtgaagaagataatatggctattattaaggaatttatgcgttttaaggtacatatggaaggtagtgttaatggtcatgaatttgaaattgaaggtgaaggagaaggtcggccatatgaaggtactcaaactgctaagttaaaggttactaaaggtggaccattaccttttgcatgggatattctttcaccacaatttatgtacggatctaaggcttatgttaagcacccagcagatattcctgattaccttaaacttagttttcctgaaggttttaagtgggaacgagttatgaattttgaagatggtggagttgtaactgtaacacaagatagttcattacaagatggagaatttatttacaaggttaagttacgtggaactaattttccatcagatggtcctgtaatgcaaaagaaaactatgggttgggaagctagtagtgaacgtatgtacccagaagatggagcattaaagggtgaaattaagcaacggcttaaacttaaggatggtggacattacgatgctgaagttaagactacatacaaggcaaaaaagccagttcaattacctggtgcttacaatgtaaatattaagttagatattacttctcacaatgaagattacacaattgttgaacaatacgaacgggcagaaggtcggcactctactggaggaatggatgaactttacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z