BBa_K1033259 1 BBa_K1033259 Toxin-antitoxin system from lactobacillus plantarum 2013-08-21T11:00:00Z 2015-05-08T01:08:49Z Lactobacillus plantarum 256 This is a toxin-antitoxin system originating from plasmid p256 from lactobacillus plantarum strain 256. (ref) It has been created without the natural promotor to allow for customisable strength of the system. The main use of the toxin-antitoxin system is to make the plasmid more stabile without having to rely on antibiotic resistance. The antitoxin has a shorter halflife then the antitoxin. If the cell were to lose the plasmid the toxin will remain longer in the cell and thereby kill it. It has been proven very efficient in previous studies. (ref) false false _1340_ 0 14332 9 In stock false The system has been amplified without RBS and its natural promotor. Since that promotor has not been characterized as far as we know, several promoters will probably have to be tried to find one that provides stability without adding to much cost of expressing the toxin-antitoxin. There is also a version available with the natural promoter and RBS. false Anders Edlund BBa_K1033259_sequence 1 ggaggggaaaatatggaacttattaaagaacaaacacgcttagcaaagtggggaaactcgaaagctgctagaattcctagccaaattattaaacaactgaaattagatgataaccaagatatgacaataaccattgaaaatggatcaattgttttaacaccaataaaaaagaacccaaccaatattcacgaactatttaaggattggaaagatgacgggaaaagggatcacgagcttgattggggaaagtcagaaggtaatgaacttcaatggtaagccaaggtgatatattttatgttaactttaatccaagccgtggtcatgaacagatgaataagcgaccagccattgcgctaagcaatgatctagtctgtcagacaagtaacatgacgattgtggctccaattagcagtaccaagcgtaattttccaatgtatcatcgactaactagtagtcaaacagtatatggaaaagtattattagatcaaaccatagccttagatttacgggcaagacatgtcactgatgaaactattgtcgatcatgtatcgcgtgaagaactagaagaaataatcactttgtacaaattattgtttagtattgatgacaaatagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z