BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1033930 1 BBa_K1033930 amilCP, blue/purple chromoprotein (incl RBS) 2013-09-16T11:00:00Z 2015-05-08T01:08:50Z Acropora millepora This chromoprotein from the coral Acropora millepora, amilCP, naturally exhibits strong color when expressed. The protein has an absorbance maximum at 588 nm giving it a blue/purple color visible to the naked eye, thereby requiring no instruments to observe. The strong color is readily observed in both LB or agar culture, in less than 24 hours of incubation. false false _1340_ 0 13997 9 In stock false Illegal internal restriction site had to be removed (EcoRI). false Erik Lundin component2351892 1 BBa_B0034 component2351894 1 BBa_K592009 annotation2351892 1 BBa_B0034 range2351892 1 1 12 annotation2351894 1 BBa_K592009 range2351894 1 19 687 BBa_K1033930_sequence 1 aaagaggagaaatactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z