BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592010 1 amilGFP amilGFP, yellow chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora This chromoprotein, amilGFP, naturally exhibits very strong yellow color when expressed. The color is strong and readily visible to naked eye both in LB-culture and on agar plates. The DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of two illegal internal restriction sites (EcoRI and PstI). false false _763_ 0 7929 9 It's complicated false Two illegal internal restriction sites (EcoRI and PstI) was removed. false Lei Sun annotation2131633 1 amilGFP range2131633 1 1 696 BBa_K1033931 1 BBa_K1033931 amilGFP, yellow chromoprotein (incl RBS) 2013-09-16T11:00:00Z 2015-05-08T01:08:50Z Acropora millepora. The DNA was provided by Jeffrey Miller at UCLA, and was made BioBrick-compatible by removing two illegal internal restriction sites (EcoRI and PstI). This chromoprotein from the coral Acropora millepora, amilGFP, naturally exhibits strong yellow color when expressed. The color is readily visible to naked eye both in LB-culture and on agar plates. Color development can be seen in less than 24 hours of incubation. false false _1340_ 0 13997 9 In stock false Two illegal internal restriction sites (EcoRI and PstI) were removed. false Erik Lundin component2351898 1 BBa_K592010 component2351896 1 BBa_B0034 annotation2351896 1 BBa_B0034 range2351896 1 1 12 annotation2351898 1 BBa_K592010 range2351898 1 19 717 BBa_B0034_sequence 1 aaagaggagaaa BBa_K592010_sequence 1 atgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa BBa_K1033931_sequence 1 aaagaggagaaatactagatgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z