BBa_K1033932 1 BBa_K1033932 spisPink, pink chromoprotein 2014-04-20T11:00:00Z 2015-05-08T01:08:50Z Stylophora pistillata. The protein was first extracted and characterized by Alieva et. al. under the name spisCP (GenBank: ABB17971.1). This version is codon optimized for E coli by Genscript. This chromoprotein from the coral Stylophora pistillata, spisPink (also known as spisCP), naturally exhibits strong color when expressed. The protein has an absorption maximum at 560 nm giving it a pink color visible to the naked eye. The strong color is readily observed in both LB or on agar plates after less than 24 hours of incubation. The protein spisPink has significant sequence homologies with proteins in the GFP family. false false _1340_ 0 9827 9 Not in stock false Synthesized and codon optimized for E coli by GenScript. false Erik Lundin annotation2372666 1 spisPink range2372666 1 1 678 BBa_K1033932_sequence 1 atgtcgcactcaaaacaagcactggcagatacgatgaaaatgacgtggctgatggaaggttcggtcaacggtcacgcctttacgattgaaggcgaaggtaccggcaaaccgtatgaaggtaaacagagtggcacctttcgtgttacgaaaggcggtccgctgccgtttgcgtttgatattgtcgctccgaccctgaaatacggtttcaaatgcttcatgaaatacccggcggatattccggactactttaaactggccttcccggaaggcctgacgtacgatcgtaaaattgcgtttgaagacggcggttgtgcgaccgccacggtcgaaatgagcctgaagggtaacaccctggtgcataaaacgaactttcagggcggtaatttcccgattgatggtccggtgatgcaaaaacgcaccctgggctgggaaccgacctctgaaaaaatgacgccgtgcgatggtattatcaaaggcgacaccatcatgtacctgatggttgaaggcggtaaaacgctgaaatgtcgttatgaaaacaattaccgcgccaacaaaccagtgctgatgccgccgagccactttgtggatctgcgtctgacccgcacgaatctggataaagaaggtctggcgttcaaactggaagaatatgctgttgcccgtgtgctggaagtgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z