BBa_K1039000 1 BBa_K1039000 attP site for phiC31 integrase 2013-07-07T11:00:00Z 2015-05-08T01:08:50Z Groth, A. C., Olivares, E. C., Thyagarajan, B. & Calos, M. P. (2000). A phage integrase directs efficient site-specific integration in human cells. Proc Natl Acad Sci U S A 97, 5995-6000. The attP site is the phage attachment site for the phiC31 phage. The site is recognized by phiC31 integrase. The phiC31 integrase catalyzes a unidirectional strand exchange between a 39 bp attP site and a 34 bp attB site (Groth et al., 2000). The enzyme works by making a synapse between attP and attB, making double strand breaks producing a 2 bp sticky overhang, exchanging the strands, and re-ligating them in the recombinant configuration (attL and attR). false false _1346_ 0 14183 9 In stock false none false Hina Bandukwala BBa_K1039000_sequence 1 ccccaactggggtaacctttgagttctctcagttggggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z