BBa_K1039002 1 BS2 Bxb1 J23118 promoter switch 2013-07-07T11:00:00Z 2015-05-08T01:08:50Z Ghosh, P., Kim, A. I. & Hatfull, G. F. (2003). The orientation of mycobacteriophage Bxb1 integration is solely dependent on the central dinucleotide of attP and attB. Mol Cell 12, 1101-1111. The medium strength constitutive promoter J23111 complementary sequence is flanked by the Bxb1 attP and the complementary sequence of the Bxb1 attB site. In the default state the promoter directs transcription on the negative sense strand towards the attP site. In the presence of the Bxb1 integrase the attP and attB sites are recombined and the promoter is directing transcription to the sense strand towards the attB site. false false _1346_ 0 14183 9 In stock false The transcriptional terminator J61048 was included to ensure transcription only proceeds in the expected direction. Spacer regions were added adopted from ... NheI site ... false Aaron Bender BBa_K1039002_sequence 1 gctagctcgtggtttgtctggtcaaccaccgcggtctcagtggtgtacggtacaaacccaatagcgaggaggtaaattgtaagctttagggaaacgacatttactgacgcgactttctcaaagctagggtgttggcctgaactgtacgcttggagttgtaggacagacataaaagtatcagatacgcacactaaccatctgctagcactatacctaggactgagctagccgtcaagtgacaactgtataggcgcgagagcgacggcgtgcttccggaccgggccttagcgagcgttagcacggtagtagacctttggggttgaataaccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaaatctattgtactaatcggcttcaacgtgccgcacgggtggcacctcaggaggggcccggatgatcctgacgacggagaccgccgtcgtcgacaagccggccga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z