BBa_K1039019 1 BBa_K1039019 pVIII of M13 Bacteriophage with strong RBS (B0034) 2013-09-15T11:00:00Z 2015-05-08T01:08:50Z ... ... false false _1346_ 0 14183 9 In stock false ... false Julia Manalil component2351755 1 BBa_K1039018 component2351753 1 BBa_B0034 annotation2351755 1 BBa_K1039018 range2351755 1 19 240 annotation2351753 1 BBa_B0034 range2351753 1 1 12 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1039018 1 BBa_K1039018 pVIII of M13 Bacteriophage 2013-09-15T11:00:00Z 2015-05-08T01:08:50Z ... ... false false _1346_ 0 14183 9 In stock false ... false Julia Manalil annotation2351048 1 pVIII range2351048 1 1 222 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1039019_sequence 1 aaagaggagaaatactagatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_K1039018_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z