BBa_K104002 1 BBa_K104002 Prom_spaRK 2009-09-22T11:00:00Z 2015-06-09T08:39:11Z The part comes from the sequence of the spaRK operon from Genbank entry: Bacillus subtilis spaR and spaK genes, complete coding regions, gi|143569|gb|L07785.1|BACSPARK[143569] This is the sigma H type promoter that normally drives the expression of the spaRK operon in Bacillus subtilis ATCC6633. SigmaH promoters are normally active at the early onset of stationary phase growth. false false _237_ 4206 2652 9 Not in stock false This promoter forms part of the complex device BBa_K104001 false Anil Wipat annotation2026719 1 Prom_spaRK range2026719 1 1 117 BBa_K104002_sequence 1 atccgcatgaaataaattcaggggtattgatgatggtttttggtataatatgtacaatcattgccagtcttatatggtttagtaaatgggaaggcagaaaaacgtttgaatagtatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z