BBa_K104007 1 BBa_K104007 Term_rrnO 2009-10-13T11:00:00Z 2015-06-09T08:51:00Z The sequence was derived from DBTBS http://dbtbs.hgc.jp/COG/prom/rrnO-16S-trnO-Ile-trnO-Ala-rrnO-23S-rrnO-5S.html This is an efficient termintor sequence from Bacillus that normally terminates the rrnO-16S-trnO-Ile-trnO-Ala-rrnO-23S-rrnO-5S operon. false false _237_ 4206 2652 9 Not in stock false This terminator forms part of the complex device BBa_K104001 false Anil Wipat BBa_K104007_sequence 1 ttaaacccagctcaatgagctgggttttttgtttgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z