BBa_K174015 1 BBa_K174015 Cadmium Sensor 2009-10-13T11:00:00Z 2015-05-08T01:10:58Z CadA promoter which has the binding site for CzrA protein is combined with ArsR binding site to create this AND gate Cadmium sensor. This Cadmium sensor has binding sites for ArsR and CzrA metal sensors. By placing them together, our device works as an AND gate and senses Cadmium when both proteins bind to Cadmium. When Cadmium is not present both proteins bind to their relevant sites on the promoter and represses the expression of downstream genes. When Cadmium present in the environment, it binds to these repressors which then fall of from where they are bound to on the promoter. Hence the promoter becomes free to express the downstream genes as an indication of Cadmium. This combinatorial approach enables us to filter out sensing other metals. ArsR and CzrA can bind to different metals, however when both are used as an ANd gate, they will only recognize Cadmium. false false _277_ 0 3942 9 It's complicated true We wanted to sense Cadmium accurately and used a combinatorial approach to achieve our goal. false The Newcastle 2009 iGEM team component2040856 1 BBa_K174017 component2040851 1 BBa_K174016 annotation2040851 1 BBa_K174016 range2040851 1 1 26 annotation2040856 1 BBa_K174017 range2040856 1 35 205 BBa_K174017 1 BBa_K174017 CadA promoter with CzrA binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:17Z It is taken from ''B. subtilis'' ''cadA'' promoter. In ''B. subtilis'' CadA system works as an efflux system to take the metals out in the cell. It is normally repressed by CzrA repressor protein. When certain metals get inside the cell, they can bind to CzrA and derepress the promoter expressing CadA. Hence metals are taken out by the efflux system. By taking the promoter of CadA system, we created a generic metal sensor. Hence when it is combined with coding sequences of other genes, it will regulate the expression of these genes upon sensing metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing false The Newcastle 2009 iGEM team annotation2040829 1 sigA -10 range2040829 1 42 47 annotation2040828 1 sigA -35 range2040828 1 18 23 annotation2040827 1 cadA promoter range2040827 1 11 144 annotation2040830 1 CzrA binding site range2040830 1 56 86 BBa_K174016 1 BBa_K174016 Promoterless ArsR binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:49Z ''B. subtilis'' This part purely holds the binding site for ArsR protein which can be released when bound to different metals. Hence this part can be combined with any promoter to sense metals that can bind to ArsR protein. When added in front of a promoter with another metal sensor's protein's binding site, it can form an AND gate to sensitively detect specific metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing. false The Newcastle 2009 iGEM team annotation2040774 1 ArsR binding site range2040774 1 9 26 BBa_K1042012 1 BBa_K1042012 Cadmium Promoter + P2 ogr activator 2013-09-15T11:00:00Z 2015-05-08T01:08:51Z test test false false _1349_ 0 9218 9 It's complicated false test false Parth Patel component2363628 1 BBa_K174015 component2363632 1 BBa_I746350 annotation2363632 1 BBa_I746350 range2363632 1 214 450 annotation2363628 1 BBa_K174015 range2363628 1 1 205 BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943867 1 P2 ogr range1943867 1 19 237 annotation1943865 1 B0034 range1943865 1 1 12 annotation1943866 1 P2 ogr range1943866 1 19 19 BBa_K1042012_sequence 1 agtaatcaaaataaattgatttattttactagaggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagctactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K174017_sequence 1 gcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagc BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K174015_sequence 1 agtaatcaaaataaattgatttattttactagaggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagc BBa_K174016_sequence 1 agtaatcaaaataaattgatttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z