BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K1044007 1 BBa_K1044007 T7 promoter (strong promoter from T7 bacteriophage)+RBS (Elowitz 1999) -- defines RBS efficiency 2013-09-22T11:00:00Z 2015-05-08T01:08:51Z BBa_I712074,BBa_B0034 T7 promoter (strong promoter from T7 bacteriophage)+RBS (Elowitz 1999) -- defines RBS efficiency false false _1351_ 0 16207 9 It's complicated false none false Koki Tsutsumi component2358788 1 BBa_B0034 component2358786 1 BBa_I712074 annotation2358786 1 BBa_I712074 range2358786 1 1 46 annotation2358788 1 BBa_B0034 range2358788 1 55 66 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1044007_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z