BBa_K1045001 1 BBa_K1045001 DarR ORF with inversed Pre- and Suffix 2013-06-23T11:00:00Z 2015-05-08T01:08:52Z This part was amplified from the genomic DNA of Mycobacterium smegmatis MC2 155. This is the ORF of DarR. DarR is a regulatory protein from Mycobacterium smegmatis, which can bind its specific binding sequence (the DarR_operator, see part BBa_K1045000). The binding effinciency is dependent on the availability of cyclic di-AMP, which enhances the probability of binding to DNA. Ideally, this protein will shut down transcription of information downstream of its operator. This way, transcription can be controlled via the level of c-di-AMP (e.g. for a reporter-system in order to monitor it). false false _1352_ 0 15960 9 In stock false In order to express DarR in Escherichia coli, the GTG-start codon was mutated to an ATG. Also, the first few codons were changed according to codon usage in E. coli via mutagenesis PCR (with the forward primer). false iGEM Team G??ttingen 2013 annotation2330113 1 DarR reverse range2330113 1 1 639 BBa_K1045001_sequence 1 tcagcgaggtcggccctgcgggttcgccataccggtgatcaacaggtcgaccacgttggtcgcgagttcgttgatctcgtcgagggtctgcccctcgatcctgcggtaccacatgtcgacggcgttgaggttgctcagcagtgtgcgggtggcaagtgcctcgtcgacgacgcgtagggaaccgtcggcgataccttcggccaccacacgccggaacatcagctcgtaatcgcgccggagttcgttgagcgcggcgagtgcgtcgcgctgccggatcttcagcgcggtcgaggcctggtagcgcacgccttgatgcacgacgtggtggtacccgagttcggtcatcaggttctccaggtgcgcgaccgacatcgccgccagacgctcccgcccggtccccgctccgcccgcatgcggttcgacgcgttcgcggacccggcgcataccgtcctcgtacacggccaggaagatgtcgaacttcgaccggaagtggtagtagatcaggcccttggtggcccccacctgctcggcgatgtcgtcgatggtggtgttggcgaacccgtggaccatgaacgcgtcggcggccgcatcgaggatccgggttttcacatcgatttccagttccgcgctcgcgctcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z