BBa_K1045003 1 DacA Diadenylate cyclase domain of Listeria monocytogenes cdaA (DacA) 2013-08-21T11:00:00Z 2015-05-08T01:08:52Z The part was amplified using pcr from L. monocytogenes genomic DNA. Cyclic di-AMP is involved in cell signaling of gram positive bacteria including L. monocytogenes, B. subtilis, S. aureus, and S. pneumoniae. The diadenylate cyclase domain of Listeria monocytogenes cdaA protein generates cyclic di-AMP for cell signaling. The part BBa_K1045003 described here covers the amino acids 100 to 273 of the full length coding sequence of cdaA. false false _1352_ 0 16038 9 It's complicated true The genomic sequence of the part BBa_K1045003 contained a SpeI restriction site on position 456 of the DNA sequence. The restriction site was deleted without altering the amino acid sequence of the protein. false iGEM Team G??ttingen 2013 annotation2360236 1 Start range2360236 1 1 3 annotation2360250 1 Diadenylate cyclase domain range2360250 1 1 528 annotation2360237 1 stop range2360237 1 526 528 BBa_K1045003_sequence 1 atgtatggatcaagaattgagcgtgaacagcatcatttaatcgagtctatcgaaaaatccacccaatatatggcaaaacgtcgaattggggcactgatttcagtggcacgcgatacaggcatggacgattatattgaaacaggtattccgttaaatgcaaaaatttcttctcaattattaattaatatttttattccgaatacaccgcttcatgatggagcagttattattaaaggaaacgaaattgcatcggcagcaagttacttgccactttcagatagcccgttcttatccaaagaacttggaacgcgtcaccgggctgcacttgggattagtgaagtgacagatagtattacgattgtagtttctgaagagactggcggaatttccctaactaaaggtggagaacttttccgtgatgtgtctgaagaagagttacataaaattcttcttaaagaactggtcacagtaactgcaaagaaaccttctatcttttctaaatggaaaggaggcaaaagcgaatgatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z