BBa_K105001 1 BBa_K105001 VP16 - eucaryotic activation domain 2008-10-11T11:00:00Z 2015-05-08T01:08:52Z We have constructed our BioBrick from the plasmid xxx, which was available in our hosting lab. Originally VP16 is a protein from the herpes simplex virus. It activates the transcription of the late genes of this virus by the RNA-polymerase II of the eucaryotic host. In artificial systems VP16 is used in fusion with a DNA-binding domain. This DNA-binding domain is specific for a bait sequence. So the selective expression of genes with a promoter containing this bait sequence can be achieved. false false _253_ 0 3313 9 It's complicated true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. <br\n> For more information about this issus, see Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." DSpace http://hdl.handle.net/1721.1/32535 (2006). true Manuel Gersbacher BBa_K105001_sequence 1 gctagcgccgccaccatgggccctaaaaagaagcgtaaagtcgcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccggggccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z